RTCP - Code On
Posted on sam. 25 janvier 2020 in CTF
solves : 154
Point : 500
My houseplant and I were working on a biology assignment together. Yes, my houseplant. Don't question it. Anyways, she ended up giving me a new cipher to use in my next project! So I'm giving it to my biology friends to see if they can solve it. They are, after all, studying DNA and mRNA right now.
AUGCAAGGUCUCUUGACCCAGUGGAUACUAAAUGCCUGGAAGGUAGCAUACUAG
Key: 6, 3, 4, 3, 1, 9, 8, 3, 3, 2, 7, 4, 1, 2, 4, 1
Hint : Make sure to encase the plaintext with rtcp{} Spaces are represented by a underscore, (_)
Ok. It a RNA string using the 4 letters for each fundamental units of genetic code (Adenine, Cytosine, Guanine, Uracil). We need to recover the full name of each RNA codon. We can use this picture or the tab in the Wikipedia article.
We are using the key for select the write
| Index | String |
|---|---|
| Start | |
| 6 | Glutamine |
| 3 | Glycine |
| 4 | Leucine |
| 3 | Leucine |
| 1 | Threonine |
| 9 | Glutamine |
| 8 | Tryptophan |
| 3 | Isoleucine |
| 3 | Leucine |
| 2 | Asparagine |
| 7 | Glycine |
| 4 | Tryptophan |
| 1 | Lysine |
| 2 | Valine |
| 4 | Alanine |
| 1 | Tyrosine |
| Stop |
That's give us this final flag with the right case, space and format : rtcp{my_cute_houseplant}.